NM_003300.2-1540s1c1 Accession Number(s): NM_145726.1, NM_003300.2, NM_145725.1 Region: CDS
NM_003300.2-1540s1c1 Accession Number(s): NM_145726.1, NM_003300.2, NM_145725.1 Region: CDS
7187 OMIM Accession: 601896 UCSC Genome Browser ID: NM_003300 Ref Seq NM Accession: NM_003300 NM_145725 NM_145726 Ref Seq NP Accession: NP_003291
Entrez Gene ID: 7259 OMIM Accession: 604714 Ref Seq NM Accession: NM_003309 Ref Seq NP Accession: NP_003300
... just as Anglia (England) is used for the Great Britain, the UK and sometimes for all the British Isles together though Wyspy (islands) has gained in usage since EU accession just ...
GeneTide Query Results for U133 Probe set 208315_x_at which was created from Genbank accession NM_003300
accession #: nm_000033.2 ... 003300 tgtgactaccgtgccagcagcgggggcggcccagcctctgagtcccgtggggccccggctcccaccggtgccaaa ...
submission> 9999999997-08-003300 ars 1 20070930 20080116 20080122 ...
Laferriere (003300) housed in the main collection, TAMU accession 031484 Alyssum minus var. micranthum from U.S.A., Colorado, Douglas County, Highlands Ranch; collected on 26 May ...
Edition en mode texte de Groupe UMP ... Choix du style d'écriture; Couleur du fond Police Couleur de la police Taille de la police Couleur des liens
Approved Name + small nucleolar RNA, C/D box 115-8: NR_003300.1: GenBank : UCSC Browser : HGNC ID + HGNC:33027: Accession Numbers + Status + Approved: AF250841: GenBank : UCSC Browser
Achnatherum speciosum from U.S.A., Arizona, Gila County; collected on 24 Apr 1976 by Elinor Lehto (019866) housed in the main collection, TAMU accession 010316
... Gene Model (contig mRNA transcript) Color Legend; reference: NT_026437-> NM_003300 ... accession Contig position Chromosome position Hit orientation Contig Allele Assembly
H-Invitational ID: HIT000218621: Accession number: U21092: Created date: 31-Mar-2006: Last modified: ... Database links RefSeq: NM_003300; NM_145725; NM_145726;
... The expression of the shRNA is under the control of the human H1 RNA polymerase III promoter and is terminated as illustrated. Gene Target GenBank Accession Numbers: NM_003300, NM ...
... Gene Model (contig mRNA transcript) Color Legend; reference: NT_026437-> NM_003300 ... accession Contig position Chromosome position Hit orientation Contig Allele Assembly
... du lotissement des Hauts Varengs dans le secteur du Tôt a été confié à la société Logimanche. Le lotissement sera composé de 94 logements F4 dont 79 en accession sociale à ...
La location accession est une formule juridique originale, intermédiaire entre la location et l?accession à la propriété, qui vise en priorité les familles aux revenus ...
Secondary accessions: Q12990 Q13076 Q13947 Q6AZX1 Q9UNL1. REFSEQ proteins (3 alternative ... 208315_x_at 2, 3: U133-A: 1: 1.00: 1.00----NM_003300: 0.60: 1.00: 0.82: 1: 221571_at 2, 3: U133-A: 1: 1.00: 1.00---- ...
GenBank accession number : NR_003300.1: Host gene : SNURF-SNRNP-UBE3A antisense: Click here to see the position on the UCSC Genome Browser: Target RNA : serotonin receptor 5HT-2C mRNA?
p class="subtextcialis">
Edition en mode texte de Groupe UMP ... Choix du style d'écriture; Couleur du fond Police Couleur de la police Taille de la police Couleur des liens
Nucleus, nucleolus Secondary accessions: O75885. REFSEQ proteins: NP_003300.1 ENSEMBL proteins: ENSP00000357597 Human Recombinant Proteins
Accession NO/ Provider Non RASVs in same AS group Mouse accession NO as ortholog/ ... NM_003300: Homo sapiens TNF receptor-associated factor 3 (TRAF3), transcript variant 3 ...
... tracking between these initial resources and ProEvo classes, we will use both PRO accessions ... Blake's contribution was provided by NIH P41 grants HG 002273 and HG 003300.
Nucleotide: NR_003300: Get FASTA: Search GEO Profiles: Nucleotide: NR_003299: Get FASTA: Search GEO ... Nucleotide: NR_003329: Get FASTA: Search GEO Profiles (View all 151 Nucleotide Accessions)
... la commercialisation d?une gamme diversifiée de logements (principalement des maisons individuelles) à des prix qui vont de 2200 ? TTC/m² pour les programmes d?accession ...
PIR: I54964. RefSeq: AP_003300.1. NP_417213.1. 3D structure databases ... Accession: Primary (citable) accession number: P23909 Secondary accession number(s)
Accession: P51960: Created: 01-OCT-1996: Last Sequence Update: sequence version 2, 01-NOV-1997 ... Sequence=VSP_003300; TISSUE SPECIFICITY: Predominantly in the testis. Very low levels in ...
... Nuclear Receptor 49 H-003400 46 H-013400 Insulin Signaling Pathway 31 H-003000 30 H-013000 Protein Hydroxylase 24 H-003300 20 H-013300 * Approximate number of genes represented by accession ...
|
|